Review



primer select program of dnastar 7.01 software  (DNASTAR)


Bioz Verified Symbol DNASTAR is a verified supplier
Bioz Manufacturer Symbol DNASTAR manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    DNASTAR primer select program of dnastar 7.01 software
    Primer Select Program Of Dnastar 7.01 Software, supplied by DNASTAR, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+select+software+program/primer+select+program+of+dnastar+7+01+software/pm37179263-48-47-47
    Average 90 stars, based on 1 article reviews
    primer select program of dnastar 7.01 software - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Software:

    Article Title: Roles of nitric oxide in inflammatory downregulation of human cytochromes P450.
    Article Snippet: .. Primers for glyceraldehydes-3-phosphate dehydrogenase (GAPDH) were designed using the Primer Select software program (DNASTAR, Inc., Madison, WI). .. Real time RT-PCR analysis was carried out on an ABI 7300 sequence detection system (Applied Biosystems, Foster City, CA) to quantify relative P450 mRNA expression in human hepatocytes.

    Article Title: Hepatic and Renal Cytochrome P450 Gene Regulation During Citrobacter rodentium Infection in Wildtype and Toll-like Receptor 4 Mutant Mice
    Article Snippet: Microsomal protein concentrations were determined by the method of Lowry et al. (1951) using bovine serum albumin as the standard. cDNA Synthesis Purified total RNA was reverse-transcribed using the SuperScript First-Strand Synthesis System for RT-PCR kit (Invitrogen, Carlsbad, CA), according to the manufacturer's protocol. .. Primer Sequences Primers for mouse P450s (excluding CYP4Fs), cytokines, acute phase proteins, and glyceraldehyde dehydrogenase (GAPDH) were designed using the Primer Select software program (DNASTAR, Inc., Madison, WI). ..

    Article Title: Gene-Specific Effects of Inflammatory Cytokines on Cytochrome P4502C, 2B6 and 3A4 mRNA Levels in Human Hepatocytes
    Article Snippet: .. Primers for GAPDH, CYP2C8 and CYP2C9 were designed using the Primer Select software program (DNASTAR, Inc., Madison, WI). .. All primers were subjected to BLASTn analysis to exclude any oligonucleotides with high similarity to other human P450 mRNA transcripts table ft1 table-wrap mode=article t1 caption a4 RT-PCR Primer List Real time RT-PCR analysis was carried out on ABI 7300 sequence detection system (Applied Biosystems, Foster City, CA) to quantify relative P450 mRNA expression in human hepatocytes.

    Article Title: Evaluation of Widely Used Diagnostic Tests To Detect West Nile Virus Infections in Horses Previously Infected with St. Louis Encephalitis Virus or Dengue Virus Type 2
    Article Snippet: .. The SLEV and DENV-2 oligonucleotide sets were designed with the Primer Select software program (DNAStar, Madison, WI) (Table 2) and were based on the available published GenBank full-length sequences. ..

    Article Title: Treatment with Cationic Liposome-DNA Complexes (CLDC) Protects Mice from Lethal Western Equine Encephalitis Virus (WEEV) Challenge
    Article Snippet: .. WEEV TaqMan virus specific primers and probe were designed against IMP and McM strains with the Primer Select software program (DNASTAR, Madison, WI) ( Logue et al. 2009 ). ..

    Article Title: Roles of Nitric Oxide in Inflammatory Down-Regulation of Human Cytochromes P450
    Article Snippet: .. Primers for glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were designed using the Primer Select software program (DNASTAR, Inc., Madison, WI). .. Real time RT-PCR analysis was carried out on an ABI 7300 sequence detection system (Applied Biosystems, Foster City, CA) to quantify relative P450 mRNA expression in human hepatocytes.

    Article Title: Aedes hensilli as a Potential Vector of Chikungunya and Zika Viruses
    Article Snippet: .. The DENV-2 oligonucleotide set were designed with the Primer Select software program (DNASTAR) (1085 CCAAACAACCCGCCACTCTAAG , 1244c TTTCCCCATCCTCTGTCTACCATA , and TaqMan probe 1145 FAM- AACAGACTCGCGCTGCCCAACACA -BHQ1) and were based on the published GenBank full-length sequences. .. All real-time assays were performed by using the QuantiTect probe RT-PCR reagent kit (Qiagen).

    Article Title: Evaluation of Widely Used Diagnostic Tests To Detect West Nile Virus Infections in Horses Previously Infected with St. Louis Encephalitis Virus or Dengue Virus Type 2
    Article Snippet: .. The SLEV and DENV-2 oligonucleotide sets were designed with the Primer Select software program (DNAStar, Madison, WI) ( ) and were based on the available published GenBank full-length sequences. ..

    Virus:

    Article Title: Treatment with Cationic Liposome-DNA Complexes (CLDC) Protects Mice from Lethal Western Equine Encephalitis Virus (WEEV) Challenge
    Article Snippet: .. WEEV TaqMan virus specific primers and probe were designed against IMP and McM strains with the Primer Select software program (DNASTAR, Madison, WI) ( Logue et al. 2009 ). ..



    Similar Products

    primer select program of dnastar 7.01 software  (DNASTAR)
    90
    DNASTAR primer select program of dnastar 7.01 software
    Primer Select Program Of Dnastar 7.01 Software, supplied by DNASTAR, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+select+software+program/primer+select+program+of+dnastar+7+01+software/pm37179263-48-47-47
    Average 90 stars, based on 1 article reviews
    primer select program of dnastar 7.01 software - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    primer select program dnastar 5.0 software  (DNASTAR)
    90
    DNASTAR primer select program dnastar 5.0 software
    Primer Select Program Dnastar 5.0 Software, supplied by DNASTAR, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+select+software+program/primer+select+program+dnastar+5+0+software/pm32109535-59-11-13
    Average 90 stars, based on 1 article reviews
    primer select program dnastar 5.0 software - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    primer select program of dnastar lasergene 12 software  (DNASTAR)
    90
    DNASTAR primer select program of dnastar lasergene 12 software
    Alignment of FLC chromosomes 8 (Ch08), 13 (Ch13), and 20 (Ch20) sequence obtained from summer (CO46 and DH55) and winter (Joelle) annual genotypes of Camelina sativa . Coding sequence (CDS) was obtained from Trinity‐assembled RNAseq reads (CO46 and Joelle) or from NCBI (DH55), and consensus sequence (Cons) was obtained from sequencing of PCR‐amplified cDNA. Sequence alignments were developed using the Megalign Pro application in DNASTAR <t>Lasergene</t> <t>12</t> software
    Primer Select Program Of Dnastar Lasergene 12 Software, supplied by DNASTAR, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+select+software+program/Lasergene/pmc06508819-88-14-14
    Average 90 stars, based on 1 article reviews
    primer select program of dnastar lasergene 12 software - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    primer select software program  (DNASTAR)
    90
    DNASTAR primer select software program
    Alignment of FLC chromosomes 8 (Ch08), 13 (Ch13), and 20 (Ch20) sequence obtained from summer (CO46 and DH55) and winter (Joelle) annual genotypes of Camelina sativa . Coding sequence (CDS) was obtained from Trinity‐assembled RNAseq reads (CO46 and Joelle) or from NCBI (DH55), and consensus sequence (Cons) was obtained from sequencing of PCR‐amplified cDNA. Sequence alignments were developed using the Megalign Pro application in DNASTAR <t>Lasergene</t> <t>12</t> software
    Primer Select Software Program, supplied by DNASTAR, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+select+software+program/primer+select+software/pmc04191940-121-8-12
    Average 90 stars, based on 1 article reviews
    primer select software program - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    primer-select of lasergene 8 software program  (DNASTAR)
    90
    DNASTAR primer-select of lasergene 8 software program
    Alignment of FLC chromosomes 8 (Ch08), 13 (Ch13), and 20 (Ch20) sequence obtained from summer (CO46 and DH55) and winter (Joelle) annual genotypes of Camelina sativa . Coding sequence (CDS) was obtained from Trinity‐assembled RNAseq reads (CO46 and Joelle) or from NCBI (DH55), and consensus sequence (Cons) was obtained from sequencing of PCR‐amplified cDNA. Sequence alignments were developed using the Megalign Pro application in DNASTAR <t>Lasergene</t> <t>12</t> software
    Primer Select Of Lasergene 8 Software Program, supplied by DNASTAR, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+select+software+program/primerselect+dnastar/10__1614_slash_ws___d___13___00156__1-61-19-25
    Average 90 stars, based on 1 article reviews
    primer-select of lasergene 8 software program - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    software primer select program  (DNASTAR)
    90
    DNASTAR software primer select program
    Alignment of FLC chromosomes 8 (Ch08), 13 (Ch13), and 20 (Ch20) sequence obtained from summer (CO46 and DH55) and winter (Joelle) annual genotypes of Camelina sativa . Coding sequence (CDS) was obtained from Trinity‐assembled RNAseq reads (CO46 and Joelle) or from NCBI (DH55), and consensus sequence (Cons) was obtained from sequencing of PCR‐amplified cDNA. Sequence alignments were developed using the Megalign Pro application in DNASTAR <t>Lasergene</t> <t>12</t> software
    Software Primer Select Program, supplied by DNASTAR, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+select+software+program/primer+select+software/pm24530311-49-20-22
    Average 90 stars, based on 1 article reviews
    software primer select program - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    computer program dnastar primer select tool version 7 1  (DNASTAR)
    96
    DNASTAR computer program dnastar primer select tool version 7 1
    Alignment of FLC chromosomes 8 (Ch08), 13 (Ch13), and 20 (Ch20) sequence obtained from summer (CO46 and DH55) and winter (Joelle) annual genotypes of Camelina sativa . Coding sequence (CDS) was obtained from Trinity‐assembled RNAseq reads (CO46 and Joelle) or from NCBI (DH55), and consensus sequence (Cons) was obtained from sequencing of PCR‐amplified cDNA. Sequence alignments were developed using the Megalign Pro application in DNASTAR <t>Lasergene</t> <t>12</t> software
    Computer Program Dnastar Primer Select Tool Version 7 1, supplied by DNASTAR, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+select+software+program/PrimerSelect/pm23333856-189-9-11
    Average 96 stars, based on 1 article reviews
    computer program dnastar primer select tool version 7 1 - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    primer and probe selection software programs  (PrimerDesign Inc)
    90
    PrimerDesign Inc primer and probe selection software programs
    Alignment of FLC chromosomes 8 (Ch08), 13 (Ch13), and 20 (Ch20) sequence obtained from summer (CO46 and DH55) and winter (Joelle) annual genotypes of Camelina sativa . Coding sequence (CDS) was obtained from Trinity‐assembled RNAseq reads (CO46 and Joelle) or from NCBI (DH55), and consensus sequence (Cons) was obtained from sequencing of PCR‐amplified cDNA. Sequence alignments were developed using the Megalign Pro application in DNASTAR <t>Lasergene</t> <t>12</t> software
    Primer And Probe Selection Software Programs, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+select+software+program/probe+and+primer+design/10__1016_slash_j__clinmicnews__2012__03__003-88-9-0
    Average 90 stars, based on 1 article reviews
    primer and probe selection software programs - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Alignment of FLC chromosomes 8 (Ch08), 13 (Ch13), and 20 (Ch20) sequence obtained from summer (CO46 and DH55) and winter (Joelle) annual genotypes of Camelina sativa . Coding sequence (CDS) was obtained from Trinity‐assembled RNAseq reads (CO46 and Joelle) or from NCBI (DH55), and consensus sequence (Cons) was obtained from sequencing of PCR‐amplified cDNA. Sequence alignments were developed using the Megalign Pro application in DNASTAR Lasergene 12 software

    Journal: Plant Direct

    Article Title: Expression of FLOWERING LOCUS C and a frameshift mutation of this gene on chromosome 20 differentiate a summer and winter annual biotype of Camelina sativa

    doi: 10.1002/pld3.60

    Figure Lengend Snippet: Alignment of FLC chromosomes 8 (Ch08), 13 (Ch13), and 20 (Ch20) sequence obtained from summer (CO46 and DH55) and winter (Joelle) annual genotypes of Camelina sativa . Coding sequence (CDS) was obtained from Trinity‐assembled RNAseq reads (CO46 and Joelle) or from NCBI (DH55), and consensus sequence (Cons) was obtained from sequencing of PCR‐amplified cDNA. Sequence alignments were developed using the Megalign Pro application in DNASTAR Lasergene 12 software

    Article Snippet: Primers (Supporting Information Table ) were designed using the Primer Select program of DNASTAR Lasergene 12 software (DNASTAR, Inc., Madison, WI, USA) to specifically amplify cDNA based on the assembled camelina RNAseq and WGS of CO46 and Joelle.

    Techniques: Sequencing, Amplification, Software

    Pictograph of assembled whole genome sequence (WGS) and Trinity‐assembled RNAseq data (CDS) for FLC located on chromosomes 8 (Csa08), 13 (Csa13), and 20 (Csa20) obtained from the summer (CO46) or winter (Joelle) annual genotypes of Camelina sativa . Sequence alignments were developed using the Megalign Pro application in DNASTAR Lasergene 12 software. The full sequences corresponding to the pictograph can be viewed in Supporting Information Figure . The seven exons of FLC are outlined at the top of figure and lines connect the corresponding location of the MADS‐box (M), Intervening (I), keratin‐like (K), and C‐terminal (C) domains. Primer pairs used to amplify FLC for resequencing (UF2, UR2, DN47065R1, and DN24968F1) are included below the pictograph

    Journal: Plant Direct

    Article Title: Expression of FLOWERING LOCUS C and a frameshift mutation of this gene on chromosome 20 differentiate a summer and winter annual biotype of Camelina sativa

    doi: 10.1002/pld3.60

    Figure Lengend Snippet: Pictograph of assembled whole genome sequence (WGS) and Trinity‐assembled RNAseq data (CDS) for FLC located on chromosomes 8 (Csa08), 13 (Csa13), and 20 (Csa20) obtained from the summer (CO46) or winter (Joelle) annual genotypes of Camelina sativa . Sequence alignments were developed using the Megalign Pro application in DNASTAR Lasergene 12 software. The full sequences corresponding to the pictograph can be viewed in Supporting Information Figure . The seven exons of FLC are outlined at the top of figure and lines connect the corresponding location of the MADS‐box (M), Intervening (I), keratin‐like (K), and C‐terminal (C) domains. Primer pairs used to amplify FLC for resequencing (UF2, UR2, DN47065R1, and DN24968F1) are included below the pictograph

    Article Snippet: Primers (Supporting Information Table ) were designed using the Primer Select program of DNASTAR Lasergene 12 software (DNASTAR, Inc., Madison, WI, USA) to specifically amplify cDNA based on the assembled camelina RNAseq and WGS of CO46 and Joelle.

    Techniques: Sequencing, Software

    Alignment of amino acid sequence for FLC obtained from summer (CO46 and DH55) and winter (Joelle) annual genotypes of Camelina sativa . Sequences specific to chromosomes 8 (Ch8), 13 (Ch13), and 20 (Ch20) from the summer annual DH55 were obtained from NCBI, whereas sequence for the summer and winter annual genotypes was generated from sequence of PCR‐amplified cDNA clones. Alignments were made using the Megalign application in DNASTAR Lasergene 12 software

    Journal: Plant Direct

    Article Title: Expression of FLOWERING LOCUS C and a frameshift mutation of this gene on chromosome 20 differentiate a summer and winter annual biotype of Camelina sativa

    doi: 10.1002/pld3.60

    Figure Lengend Snippet: Alignment of amino acid sequence for FLC obtained from summer (CO46 and DH55) and winter (Joelle) annual genotypes of Camelina sativa . Sequences specific to chromosomes 8 (Ch8), 13 (Ch13), and 20 (Ch20) from the summer annual DH55 were obtained from NCBI, whereas sequence for the summer and winter annual genotypes was generated from sequence of PCR‐amplified cDNA clones. Alignments were made using the Megalign application in DNASTAR Lasergene 12 software

    Article Snippet: Primers (Supporting Information Table ) were designed using the Primer Select program of DNASTAR Lasergene 12 software (DNASTAR, Inc., Madison, WI, USA) to specifically amplify cDNA based on the assembled camelina RNAseq and WGS of CO46 and Joelle.

    Techniques: Sequencing, Generated, Amplification, Clone Assay, Software